|
|
|
|
| LEADER |
01000caa a22002652c 4500 |
| 001 |
NLM378719092 |
| 003 |
DE-627 |
| 005 |
20250306183152.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
241010s2024 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS-05-24-1009-PDN
|2 doi
|
| 028 |
5 |
2 |
|a pubmed25n1261.xml
|
| 035 |
|
|
|a (DE-627)NLM378719092
|
| 035 |
|
|
|a (NLM)39385381
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a Wintermantel, William M
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States
|
| 264 |
|
1 |
|c 2024
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 10.10.2024
|
| 500 |
|
|
|a published: Print-Electronic
|
| 500 |
|
|
|a Citation Status Publisher
|
| 520 |
|
|
|a Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread
|
| 650 |
|
4 |
|a Journal Article
|
| 650 |
|
4 |
|a Causal Agent
|
| 650 |
|
4 |
|a Pathogen detection
|
| 650 |
|
4 |
|a Subject Areas
|
| 650 |
|
4 |
|a Viruses and viroids
|
| 650 |
|
4 |
|a begomovirus
|
| 650 |
|
4 |
|a cucurbit
|
| 650 |
|
4 |
|a virus complex
|
| 650 |
|
4 |
|a whitefly
|
| 700 |
1 |
|
|a Tian, Tongyan
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Chen, Carol
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Winarto, Nicholas
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Szumski, Shelly
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Hladky, Laura Jenkins
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Gurung, Suraj
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Palumbo, John
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g (2024) vom: 09. Okt.
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnas
|
| 773 |
1 |
8 |
|g year:2024
|g day:09
|g month:10
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS-05-24-1009-PDN
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|j 2024
|b 09
|c 10
|