First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of...

Ausführliche Beschreibung

Bibliographische Detailangaben
Veröffentlicht in:Plant disease. - 1997. - (2024) vom: 11. Sept.
1. Verfasser: Chen, Fangqi (VerfasserIn)
Weitere Verfasser: Wang, Le, Jia, Ruifang, Zhang, Yuanyuan, Sun, Juan, Chen, Zhengqiang, Lin, Kejian
Format: Online-Aufsatz
Sprache:English
Veröffentlicht: 2024
Zugriff auf das übergeordnete Werk:Plant disease
Schlagworte:Journal Article Causal Agent Crop Type Disease management Ornamentals Subject Areas Viruses and viroids herbaceous/flowering plants
LEADER 01000caa a22002652c 4500
001 NLM377487775
003 DE-627
005 20250306154040.0
007 cr uuu---uuuuu
008 240912s2024 xx |||||o 00| ||eng c
024 7 |a 10.1094/PDIS-06-24-1212-PDN  |2 doi 
028 5 2 |a pubmed25n1257.xml 
035 |a (DE-627)NLM377487775 
035 |a (NLM)39261746 
040 |a DE-627  |b ger  |c DE-627  |e rakwb 
041 |a eng 
100 1 |a Chen, Fangqi  |e verfasserin  |4 aut 
245 1 0 |a First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China 
264 1 |c 2024 
336 |a Text  |b txt  |2 rdacontent 
337 |a ƒaComputermedien  |b c  |2 rdamedia 
338 |a ƒa Online-Ressource  |b cr  |2 rdacarrier 
500 |a Date Revised 11.09.2024 
500 |a published: Print-Electronic 
500 |a Citation Status Publisher 
520 |a Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management 
650 4 |a Journal Article 
650 4 |a Causal Agent 
650 4 |a Crop Type 
650 4 |a Disease management 
650 4 |a Ornamentals 
650 4 |a Subject Areas 
650 4 |a Viruses and viroids 
650 4 |a herbaceous/flowering plants 
700 1 |a Wang, Le  |e verfasserin  |4 aut 
700 1 |a Jia, Ruifang  |e verfasserin  |4 aut 
700 1 |a Zhang, Yuanyuan  |e verfasserin  |4 aut 
700 1 |a Sun, Juan  |e verfasserin  |4 aut 
700 1 |a Chen, Zhengqiang  |e verfasserin  |4 aut 
700 1 |a Lin, Kejian  |e verfasserin  |4 aut 
773 0 8 |i Enthalten in  |t Plant disease  |d 1997  |g (2024) vom: 11. Sept.  |w (DE-627)NLM098181742  |x 0191-2917  |7 nnas 
773 1 8 |g year:2024  |g day:11  |g month:09 
856 4 0 |u http://dx.doi.org/10.1094/PDIS-06-24-1212-PDN  |3 Volltext 
912 |a GBV_USEFLAG_A 
912 |a SYSFLAG_A 
912 |a GBV_NLM 
912 |a GBV_ILN_350 
951 |a AR 
952 |j 2024  |b 11  |c 09