First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and...

Ausführliche Beschreibung

Bibliographische Detailangaben
Veröffentlicht in:Plant disease. - 1997. - (2022) vom: 25. Apr.
1. Verfasser: Fernández Gamarra, Marta Alicia (VerfasserIn)
Weitere Verfasser: Chavez, Pedro, Cardozo Téllez, Lourdes Maria, Scholz, Ruth, Bobadilla, Nathalia, Vargas, Maria José, Talavera Stefani, Liliana, Enciso, Guillermo, Thach, Tine, Hovmøller, Mogens Støvring, Kohli, Man Mohan
Format: Online-Aufsatz
Sprache:English
Veröffentlicht: 2022
Zugriff auf das übergeordnete Werk:Plant disease
Schlagworte:Journal Article Causal Agent Crop Type Field crops Fungi Pathogen detection Subject Areas cereals and grains
LEADER 01000caa a22002652 4500
001 NLM339970286
003 DE-627
005 20240220232120.0
007 cr uuu---uuuuu
008 231226s2022 xx |||||o 00| ||eng c
024 7 |a 10.1094/PDIS-03-22-0482-PDN  |2 doi 
028 5 2 |a pubmed24n1300.xml 
035 |a (DE-627)NLM339970286 
035 |a (NLM)35467944 
040 |a DE-627  |b ger  |c DE-627  |e rakwb 
041 |a eng 
100 1 |a Fernández Gamarra, Marta Alicia  |e verfasserin  |4 aut 
245 1 0 |a First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay 
264 1 |c 2022 
336 |a Text  |b txt  |2 rdacontent 
337 |a ƒaComputermedien  |b c  |2 rdamedia 
338 |a ƒa Online-Ressource  |b cr  |2 rdacarrier 
500 |a Date Revised 20.02.2024 
500 |a published: Print-Electronic 
500 |a Citation Status Publisher 
520 |a Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 μm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 μm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the β-tubulin 1 gene (tub1) (Kuzdraliński et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics 
650 4 |a Journal Article 
650 4 |a Causal Agent 
650 4 |a Crop Type 
650 4 |a Field crops 
650 4 |a Fungi 
650 4 |a Pathogen detection 
650 4 |a Subject Areas 
650 4 |a cereals and grains 
700 1 |a Chavez, Pedro  |e verfasserin  |4 aut 
700 1 |a Cardozo Téllez, Lourdes Maria  |e verfasserin  |4 aut 
700 1 |a Scholz, Ruth  |e verfasserin  |4 aut 
700 1 |a Bobadilla, Nathalia  |e verfasserin  |4 aut 
700 1 |a Vargas, Maria José  |e verfasserin  |4 aut 
700 1 |a Talavera Stefani, Liliana  |e verfasserin  |4 aut 
700 1 |a Enciso, Guillermo  |e verfasserin  |4 aut 
700 1 |a Thach, Tine  |e verfasserin  |4 aut 
700 1 |a Hovmøller, Mogens Støvring  |e verfasserin  |4 aut 
700 1 |a Kohli, Man Mohan  |e verfasserin  |4 aut 
773 0 8 |i Enthalten in  |t Plant disease  |d 1997  |g (2022) vom: 25. Apr.  |w (DE-627)NLM098181742  |x 0191-2917  |7 nnns 
773 1 8 |g year:2022  |g day:25  |g month:04 
856 4 0 |u http://dx.doi.org/10.1094/PDIS-03-22-0482-PDN  |3 Volltext 
912 |a GBV_USEFLAG_A 
912 |a SYSFLAG_A 
912 |a GBV_NLM 
912 |a GBV_ILN_350 
951 |a AR 
952 |j 2022  |b 25  |c 04