Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for mo...

Ausführliche Beschreibung

Bibliographische Detailangaben
Veröffentlicht in:Plant disease. - 1997. - (2020) vom: 02. Okt.
1. Verfasser: Xuan, Zhiyou (VerfasserIn)
Weitere Verfasser: Xie, Jiaxi, Yu, Haodong, Zhang, Song, Li, Ruhui, Cao, Mengji
Format: Online-Aufsatz
Sprache:English
Veröffentlicht: 2020
Zugriff auf das übergeordnete Werk:Plant disease
Schlagworte:Journal Article Causal Agent Crop Type Etiology Subject Areas Trees Viruses and viroids
LEADER 01000caa a22002652c 4500
001 NLM315768959
003 DE-627
005 20250228033032.0
007 cr uuu---uuuuu
008 231225s2020 xx |||||o 00| ||eng c
024 7 |a 10.1094/PDIS-07-20-1580-PDN  |2 doi 
028 5 2 |a pubmed25n1052.xml 
035 |a (DE-627)NLM315768959 
035 |a (NLM)33006524 
040 |a DE-627  |b ger  |c DE-627  |e rakwb 
041 |a eng 
100 1 |a Xuan, Zhiyou  |e verfasserin  |4 aut 
245 1 0 |a Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China 
264 1 |c 2020 
336 |a Text  |b txt  |2 rdacontent 
337 |a ƒaComputermedien  |b c  |2 rdamedia 
338 |a ƒa Online-Ressource  |b cr  |2 rdacarrier 
500 |a Date Revised 22.02.2024 
500 |a published: Print-Electronic 
500 |a Citation Status Publisher 
520 |a Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV 
650 4 |a Journal Article 
650 4 |a Causal Agent 
650 4 |a Crop Type 
650 4 |a Etiology 
650 4 |a Subject Areas 
650 4 |a Trees 
650 4 |a Viruses and viroids 
700 1 |a Xie, Jiaxi  |e verfasserin  |4 aut 
700 1 |a Yu, Haodong  |e verfasserin  |4 aut 
700 1 |a Zhang, Song  |e verfasserin  |4 aut 
700 1 |a Li, Ruhui  |e verfasserin  |4 aut 
700 1 |a Cao, Mengji  |e verfasserin  |4 aut 
773 0 8 |i Enthalten in  |t Plant disease  |d 1997  |g (2020) vom: 02. Okt.  |w (DE-627)NLM098181742  |x 0191-2917  |7 nnas 
773 1 8 |g year:2020  |g day:02  |g month:10 
856 4 0 |u http://dx.doi.org/10.1094/PDIS-07-20-1580-PDN  |3 Volltext 
912 |a GBV_USEFLAG_A 
912 |a SYSFLAG_A 
912 |a GBV_NLM 
912 |a GBV_ILN_350 
951 |a AR 
952 |j 2020  |b 02  |c 10