|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM295562072 |
| 003 |
DE-627 |
| 005 |
20231225083931.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s2019 xx |||||o 00| ||chi c |
| 024 |
7 |
|
|a 10.3760/cma.j.issn.0578-1310.2019.04.011
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0985.xml
|
| 035 |
|
|
|a (DE-627)NLM295562072
|
| 035 |
|
|
|a (NLM)30934202
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a chi
|
| 100 |
1 |
|
|a Zhao, S L
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a Clinical features and MYH9 gene variant in two Chinese siblings with Fechtner syndrome
|
| 264 |
|
1 |
|c 2019
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Completed 25.04.2019
|
| 500 |
|
|
|a Date Revised 25.04.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status MEDLINE
|
| 520 |
|
|
|a Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome
|
| 650 |
|
4 |
|a Journal Article
|
| 650 |
|
4 |
|a Genetic testing
|
| 650 |
|
4 |
|a Proteinuria
|
| 650 |
|
4 |
|a Thrombocytopenia
|
| 650 |
|
7 |
|a MYH9 protein, human
|2 NLM
|
| 650 |
|
7 |
|a Molecular Motor Proteins
|2 NLM
|
| 650 |
|
7 |
|a Myosin Heavy Chains
|2 NLM
|
| 650 |
|
7 |
|a EC 3.6.4.1
|2 NLM
|
| 700 |
1 |
|
|a Zhao, F
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Zhang, A H
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Huang, S M
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Zhonghua er ke za zhi = Chinese journal of pediatrics
|d 1960
|g 57(2019), 4 vom: 02. Apr., Seite 286-290
|w (DE-627)NLM136249191
|x 0578-1310
|7 nnns
|
| 773 |
1 |
8 |
|g volume:57
|g year:2019
|g number:4
|g day:02
|g month:04
|g pages:286-290
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.3760/cma.j.issn.0578-1310.2019.04.011
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_11
|
| 912 |
|
|
|a GBV_ILN_20
|
| 912 |
|
|
|a GBV_ILN_22
|
| 912 |
|
|
|a GBV_ILN_24
|
| 912 |
|
|
|a GBV_ILN_31
|
| 912 |
|
|
|a GBV_ILN_39
|
| 912 |
|
|
|a GBV_ILN_40
|
| 912 |
|
|
|a GBV_ILN_50
|
| 912 |
|
|
|a GBV_ILN_61
|
| 912 |
|
|
|a GBV_ILN_65
|
| 912 |
|
|
|a GBV_ILN_69
|
| 912 |
|
|
|a GBV_ILN_70
|
| 912 |
|
|
|a GBV_ILN_72
|
| 912 |
|
|
|a GBV_ILN_120
|
| 912 |
|
|
|a GBV_ILN_130
|
| 912 |
|
|
|a GBV_ILN_227
|
| 912 |
|
|
|a GBV_ILN_244
|
| 912 |
|
|
|a GBV_ILN_285
|
| 912 |
|
|
|a GBV_ILN_294
|
| 912 |
|
|
|a GBV_ILN_350
|
| 912 |
|
|
|a GBV_ILN_665
|
| 912 |
|
|
|a GBV_ILN_813
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 57
|j 2019
|e 4
|b 02
|c 04
|h 286-290
|