A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyl...

Description complète

Détails bibliographiques
Publié dans:Plant disease. - 1997. - 82(1998), 3 vom: 28. März, Seite 285-290
Auteur principal: Pan, Y-B (Auteur)
Autres auteurs: Grisham, M P, Burner, D M, Damann, K E Jr, Wei, Q
Format: Article en ligne
Langue:English
Publié: 1998
Accès à la collection:Plant disease
Sujets:Journal Article
LEADER 01000caa a22002652 4500
001 NLM294803912
003 DE-627
005 20250225003257.0
007 cr uuu---uuuuu
008 231225s1998 xx |||||o 00| ||eng c
024 7 |a 10.1094/PDIS.1998.82.3.285  |2 doi 
028 5 2 |a pubmed25n0982.xml 
035 |a (DE-627)NLM294803912 
035 |a (NLM)30856858 
040 |a DE-627  |b ger  |c DE-627  |e rakwb 
041 |a eng 
100 1 |a Pan, Y-B  |e verfasserin  |4 aut 
245 1 2 |a A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease 
264 1 |c 1998 
336 |a Text  |b txt  |2 rdacontent 
337 |a ƒaComputermedien  |b c  |2 rdamedia 
338 |a ƒa Online-Ressource  |b cr  |2 rdacarrier 
500 |a Date Revised 20.11.2019 
500 |a published: Print 
500 |a Citation Status PubMed-not-MEDLINE 
520 |a A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay 
650 4 |a Journal Article 
700 1 |a Grisham, M P  |e verfasserin  |4 aut 
700 1 |a Burner, D M  |e verfasserin  |4 aut 
700 1 |a Damann, K E  |c Jr  |e verfasserin  |4 aut 
700 1 |a Wei, Q  |e verfasserin  |4 aut 
773 0 8 |i Enthalten in  |t Plant disease  |d 1997  |g 82(1998), 3 vom: 28. März, Seite 285-290  |w (DE-627)NLM098181742  |x 0191-2917  |7 nnns 
773 1 8 |g volume:82  |g year:1998  |g number:3  |g day:28  |g month:03  |g pages:285-290 
856 4 0 |u http://dx.doi.org/10.1094/PDIS.1998.82.3.285  |3 Volltext 
912 |a GBV_USEFLAG_A 
912 |a SYSFLAG_A 
912 |a GBV_NLM 
912 |a GBV_ILN_350 
951 |a AR 
952 |d 82  |j 1998  |e 3  |b 28  |c 03  |h 285-290