|
|
|
|
LEADER |
01000caa a22002652 4500 |
001 |
NLM294803912 |
003 |
DE-627 |
005 |
20250225003257.0 |
007 |
cr uuu---uuuuu |
008 |
231225s1998 xx |||||o 00| ||eng c |
024 |
7 |
|
|a 10.1094/PDIS.1998.82.3.285
|2 doi
|
028 |
5 |
2 |
|a pubmed25n0982.xml
|
035 |
|
|
|a (DE-627)NLM294803912
|
035 |
|
|
|a (NLM)30856858
|
040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
041 |
|
|
|a eng
|
100 |
1 |
|
|a Pan, Y-B
|e verfasserin
|4 aut
|
245 |
1 |
2 |
|a A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease
|
264 |
|
1 |
|c 1998
|
336 |
|
|
|a Text
|b txt
|2 rdacontent
|
337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
500 |
|
|
|a Date Revised 20.11.2019
|
500 |
|
|
|a published: Print
|
500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
520 |
|
|
|a A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay
|
650 |
|
4 |
|a Journal Article
|
700 |
1 |
|
|a Grisham, M P
|e verfasserin
|4 aut
|
700 |
1 |
|
|a Burner, D M
|e verfasserin
|4 aut
|
700 |
1 |
|
|a Damann, K E
|c Jr
|e verfasserin
|4 aut
|
700 |
1 |
|
|a Wei, Q
|e verfasserin
|4 aut
|
773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 82(1998), 3 vom: 28. März, Seite 285-290
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
773 |
1 |
8 |
|g volume:82
|g year:1998
|g number:3
|g day:28
|g month:03
|g pages:285-290
|
856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS.1998.82.3.285
|3 Volltext
|
912 |
|
|
|a GBV_USEFLAG_A
|
912 |
|
|
|a SYSFLAG_A
|
912 |
|
|
|a GBV_NLM
|
912 |
|
|
|a GBV_ILN_350
|
951 |
|
|
|a AR
|
952 |
|
|
|d 82
|j 1998
|e 3
|b 28
|c 03
|h 285-290
|