|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM294651659 |
| 003 |
DE-627 |
| 005 |
20231225081941.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s1999 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS.1999.83.12.1176D
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0982.xml
|
| 035 |
|
|
|a (DE-627)NLM294651659
|
| 035 |
|
|
|a (NLM)30841149
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a Reina, J
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus
|
| 264 |
|
1 |
|c 1999
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 20.11.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
| 520 |
|
|
|a Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999
|
| 650 |
|
4 |
|a Journal Article
|
| 700 |
1 |
|
|a Morilla, G
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Bejarano, E R
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Rodríguez, M D
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Janssen, D
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 83(1999), 12 vom: 30. Dez., Seite 1176
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
| 773 |
1 |
8 |
|g volume:83
|g year:1999
|g number:12
|g day:30
|g month:12
|g pages:1176
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS.1999.83.12.1176D
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 83
|j 1999
|e 12
|b 30
|c 12
|h 1176
|