|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM294370064 |
| 003 |
DE-627 |
| 005 |
20231225081332.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s2004 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS.2004.88.2.223C
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0981.xml
|
| 035 |
|
|
|a (DE-627)NLM294370064
|
| 035 |
|
|
|a (NLM)30812443
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a Tzanetakis, I E
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a First Report of Beet pseudo yellows virus in Blackberry in the United States
|
| 264 |
|
1 |
|c 2004
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 20.11.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
| 520 |
|
|
|a Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCRCTAATGATA 3') that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004
|
| 650 |
|
4 |
|a Journal Article
|
| 700 |
1 |
|
|a Martin, R R
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 88(2004), 2 vom: 20. Feb., Seite 223
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
| 773 |
1 |
8 |
|g volume:88
|g year:2004
|g number:2
|g day:20
|g month:02
|g pages:223
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS.2004.88.2.223C
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 88
|j 2004
|e 2
|b 20
|c 02
|h 223
|