|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM293491216 |
| 003 |
DE-627 |
| 005 |
20231225075432.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s2013 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS-01-13-0092-PDN
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0978.xml
|
| 035 |
|
|
|a (DE-627)NLM293491216
|
| 035 |
|
|
|a (NLM)30722500
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a González-Pacheco, B E
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants
|
| 264 |
|
1 |
|c 2013
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 20.11.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
| 520 |
|
|
|a Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001
|
| 650 |
|
4 |
|a Journal Article
|
| 700 |
1 |
|
|a Silva-Rosales, L
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 97(2013), 8 vom: 05. Aug., Seite 1124
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
| 773 |
1 |
8 |
|g volume:97
|g year:2013
|g number:8
|g day:05
|g month:08
|g pages:1124
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS-01-13-0092-PDN
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 97
|j 2013
|e 8
|b 05
|c 08
|h 1124
|