|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM293353670 |
| 003 |
DE-627 |
| 005 |
20231225075131.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s2014 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS-09-13-0953-PDN
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0977.xml
|
| 035 |
|
|
|a (DE-627)NLM293353670
|
| 035 |
|
|
|a (NLM)30708538
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a Gao, B
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China
|
| 264 |
|
1 |
|c 2014
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 20.11.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
| 520 |
|
|
|a Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983
|
| 650 |
|
4 |
|a Journal Article
|
| 700 |
1 |
|
|a Wang, R Y
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Chen, S L
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Li, X H
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Ma, J
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 98(2014), 5 vom: 01. Mai, Seite 702
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
| 773 |
1 |
8 |
|g volume:98
|g year:2014
|g number:5
|g day:01
|g month:05
|g pages:702
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS-09-13-0953-PDN
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 98
|j 2014
|e 5
|b 01
|c 05
|h 702
|