|
|
|
|
| LEADER |
01000naa a22002652 4500 |
| 001 |
NLM293267367 |
| 003 |
DE-627 |
| 005 |
20231225074939.0 |
| 007 |
cr uuu---uuuuu |
| 008 |
231225s2015 xx |||||o 00| ||eng c |
| 024 |
7 |
|
|a 10.1094/PDIS-05-14-0543-PDN
|2 doi
|
| 028 |
5 |
2 |
|a pubmed24n0977.xml
|
| 035 |
|
|
|a (DE-627)NLM293267367
|
| 035 |
|
|
|a (NLM)30699773
|
| 040 |
|
|
|a DE-627
|b ger
|c DE-627
|e rakwb
|
| 041 |
|
|
|a eng
|
| 100 |
1 |
|
|a Xu, F
|e verfasserin
|4 aut
|
| 245 |
1 |
0 |
|a First Report of Fusarium pseudograminearum from Wheat Heads with Fusarium Head Blight in North China Plain
|
| 264 |
|
1 |
|c 2015
|
| 336 |
|
|
|a Text
|b txt
|2 rdacontent
|
| 337 |
|
|
|a ƒaComputermedien
|b c
|2 rdamedia
|
| 338 |
|
|
|a ƒa Online-Ressource
|b cr
|2 rdacarrier
|
| 500 |
|
|
|a Date Revised 20.11.2019
|
| 500 |
|
|
|a published: Print
|
| 500 |
|
|
|a Citation Status PubMed-not-MEDLINE
|
| 520 |
|
|
|a Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 104 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009
|
| 650 |
|
4 |
|a Journal Article
|
| 700 |
1 |
|
|a Song, Y L
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Yang, G Q
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Wang, J M
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Liu, L L
|e verfasserin
|4 aut
|
| 700 |
1 |
|
|a Li, Y H
|e verfasserin
|4 aut
|
| 773 |
0 |
8 |
|i Enthalten in
|t Plant disease
|d 1997
|g 99(2015), 1 vom: 31. Jan., Seite 156
|w (DE-627)NLM098181742
|x 0191-2917
|7 nnns
|
| 773 |
1 |
8 |
|g volume:99
|g year:2015
|g number:1
|g day:31
|g month:01
|g pages:156
|
| 856 |
4 |
0 |
|u http://dx.doi.org/10.1094/PDIS-05-14-0543-PDN
|3 Volltext
|
| 912 |
|
|
|a GBV_USEFLAG_A
|
| 912 |
|
|
|a SYSFLAG_A
|
| 912 |
|
|
|a GBV_NLM
|
| 912 |
|
|
|a GBV_ILN_350
|
| 951 |
|
|
|a AR
|
| 952 |
|
|
|d 99
|j 2015
|e 1
|b 31
|c 01
|h 156
|