First Report of Grapevine leafroll-associated virus 2 Infecting Muscadine (Vitis rotundifolia) and Summer Grape (Vitis aestivalis) in the United States

A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) g...

Ausführliche Beschreibung

Bibliographische Detailangaben
Veröffentlicht in:Plant disease. - 1997. - 99(2015), 1 vom: 31. Jan., Seite 163
1. Verfasser: Aboughanem-Sabanadzovic, N (VerfasserIn)
Weitere Verfasser: Sabanadzovic, S
Format: Online-Aufsatz
Sprache:English
Veröffentlicht: 2015
Zugriff auf das übergeordnete Werk:Plant disease
Schlagworte:Journal Article
LEADER 01000naa a22002652 4500
001 NLM29326726X
003 DE-627
005 20231225074939.0
007 cr uuu---uuuuu
008 231225s2015 xx |||||o 00| ||eng c
024 7 |a 10.1094/PDIS-12-13-1252-PDN  |2 doi 
028 5 2 |a pubmed24n0977.xml 
035 |a (DE-627)NLM29326726X 
035 |a (NLM)30699763 
040 |a DE-627  |b ger  |c DE-627  |e rakwb 
041 |a eng 
100 1 |a Aboughanem-Sabanadzovic, N  |e verfasserin  |4 aut 
245 1 0 |a First Report of Grapevine leafroll-associated virus 2 Infecting Muscadine (Vitis rotundifolia) and Summer Grape (Vitis aestivalis) in the United States 
264 1 |c 2015 
336 |a Text  |b txt  |2 rdacontent 
337 |a ƒaComputermedien  |b c  |2 rdamedia 
338 |a ƒa Online-Ressource  |b cr  |2 rdacarrier 
500 |a Date Revised 20.11.2019 
500 |a published: Print 
500 |a Citation Status PubMed-not-MEDLINE 
520 |a A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5'TCGGCGTACATCCCAACTTAC3' and LR-2R: 5'CTGAGTGAAACGCACTGATC3'), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to "93/955 subgroup," whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus. References: (1) R. Alkowni et al. Virus Genes 43:102, 2011. (2) N. Bertazzon et al. Eur. J. Plant Pathol. 127:185, 2010. (3) B. Meng et al. Virus Genes 31:31, 2005. (4) S. Sabanadzovic et al. Virology 394:1, 2009. (5) T. Tian et al. Phytopathology 86:1167, 1996 
650 4 |a Journal Article 
700 1 |a Sabanadzovic, S  |e verfasserin  |4 aut 
773 0 8 |i Enthalten in  |t Plant disease  |d 1997  |g 99(2015), 1 vom: 31. Jan., Seite 163  |w (DE-627)NLM098181742  |x 0191-2917  |7 nnns 
773 1 8 |g volume:99  |g year:2015  |g number:1  |g day:31  |g month:01  |g pages:163 
856 4 0 |u http://dx.doi.org/10.1094/PDIS-12-13-1252-PDN  |3 Volltext 
912 |a GBV_USEFLAG_A 
912 |a SYSFLAG_A 
912 |a GBV_NLM 
912 |a GBV_ILN_350 
951 |a AR 
952 |d 99  |j 2015  |e 1  |b 31  |c 01  |h 163